A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family
Abstract Background Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chi...
| Main Authors: | , , , , , , , , , , , , , , , , , , , , , |
|---|---|
| Format: | Article |
| Language: | English |
| Published: |
BMC
2019-12-01
|
| Series: | BMC Medical Genetics |
| Subjects: | |
| Online Access: | https://doi.org/10.1186/s12881-019-0908-6 |
| _version_ | 1818329521492852736 |
|---|---|
| author | Tahir Zaib Wei Ji Komal Saleem Guangchen Nie Chao Li Lin Cao Baijun Xu Kexian Dong Hanfei Yu Xuguang Hao Yan Xue Shuhan Si Xueyuan Jia Jie Wu Xuelong Zhang Rongwei Guan Guohua Ji Jing Bai Feng Chen Yong Liu Wenjing Sun Songbin Fu |
| author_facet | Tahir Zaib Wei Ji Komal Saleem Guangchen Nie Chao Li Lin Cao Baijun Xu Kexian Dong Hanfei Yu Xuguang Hao Yan Xue Shuhan Si Xueyuan Jia Jie Wu Xuelong Zhang Rongwei Guan Guohua Ji Jing Bai Feng Chen Yong Liu Wenjing Sun Songbin Fu |
| author_sort | Tahir Zaib |
| collection | DOAJ |
| description | Abstract Background Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. Methods We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. Results Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. Conclusion Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1. |
| first_indexed | 2024-12-13T12:49:23Z |
| format | Article |
| id | doaj.art-08ae1d772caf4e608fea4fa8a07f1b5c |
| institution | Directory Open Access Journal |
| issn | 1471-2350 |
| language | English |
| last_indexed | 2024-12-13T12:49:23Z |
| publishDate | 2019-12-01 |
| publisher | BMC |
| record_format | Article |
| series | BMC Medical Genetics |
| spelling | doaj.art-08ae1d772caf4e608fea4fa8a07f1b5c2022-12-21T23:45:22ZengBMCBMC Medical Genetics1471-23502019-12-012011910.1186/s12881-019-0908-6A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese familyTahir Zaib0Wei Ji1Komal Saleem2Guangchen Nie3Chao Li4Lin Cao5Baijun Xu6Kexian Dong7Hanfei Yu8Xuguang Hao9Yan Xue10Shuhan Si11Xueyuan Jia12Jie Wu13Xuelong Zhang14Rongwei Guan15Guohua Ji16Jing Bai17Feng Chen18Yong Liu19Wenjing Sun20Songbin Fu21Laboratory of Medical Genetics, Harbin Medical UniversityLaboratory of Medical Genetics, Harbin Medical UniversityLaboratory of Medical Genetics, Harbin Medical UniversityDepartment of Hand Surgery the Fifth Hospital of HarbinDepartment of Orthopaedic Surgery the Second Affiliated Hospital of Harbin Medical UniversityDepartment of Hepatopancreatobiliary Surgery the Second Affiliated Hospital of Harbin Medical UniversityDepartment of Radiology Suihua Cancer HospitalLaboratory of Medical Genetics, Harbin Medical UniversityLaboratory of Medical Genetics, Harbin Medical UniversityDepartment of Hand Surgery the Fifth Hospital of HarbinDepartment of Hand Surgery the Fifth Hospital of HarbinLaboratory of Medical Genetics, Harbin Medical UniversityLaboratory of Medical Genetics, Harbin Medical UniversityLaboratory of Medical Genetics, Harbin Medical UniversityLaboratory of Medical Genetics, Harbin Medical UniversityLaboratory of Medical Genetics, Harbin Medical UniversityLaboratory of Medical Genetics, Harbin Medical UniversityLaboratory of Medical Genetics, Harbin Medical UniversityLaboratory of Medical Genetics, Harbin Medical UniversityDepartment of Hand Surgery the Fifth Hospital of HarbinLaboratory of Medical Genetics, Harbin Medical UniversityLaboratory of Medical Genetics, Harbin Medical UniversityAbstract Background Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. Methods We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. Results Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. Conclusion Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.https://doi.org/10.1186/s12881-019-0908-6SPD1HOXD13Whole genome sequencingVariable expressivity |
| spellingShingle | Tahir Zaib Wei Ji Komal Saleem Guangchen Nie Chao Li Lin Cao Baijun Xu Kexian Dong Hanfei Yu Xuguang Hao Yan Xue Shuhan Si Xueyuan Jia Jie Wu Xuelong Zhang Rongwei Guan Guohua Ji Jing Bai Feng Chen Yong Liu Wenjing Sun Songbin Fu A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family BMC Medical Genetics SPD1 HOXD13 Whole genome sequencing Variable expressivity |
| title | A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family |
| title_full | A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family |
| title_fullStr | A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family |
| title_full_unstemmed | A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family |
| title_short | A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family |
| title_sort | heterozygous duplication variant of the hoxd13 gene caused synpolydactyly type 1 with variable expressivity in a chinese family |
| topic | SPD1 HOXD13 Whole genome sequencing Variable expressivity |
| url | https://doi.org/10.1186/s12881-019-0908-6 |
| work_keys_str_mv | AT tahirzaib aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT weiji aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT komalsaleem aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT guangchennie aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT chaoli aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT lincao aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT baijunxu aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT kexiandong aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT hanfeiyu aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT xuguanghao aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT yanxue aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT shuhansi aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT xueyuanjia aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT jiewu aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT xuelongzhang aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT rongweiguan aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT guohuaji aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT jingbai aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT fengchen aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT yongliu aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT wenjingsun aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT songbinfu aheterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT tahirzaib heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT weiji heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT komalsaleem heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT guangchennie heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT chaoli heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT lincao heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT baijunxu heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT kexiandong heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT hanfeiyu heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT xuguanghao heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT yanxue heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT shuhansi heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT xueyuanjia heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT jiewu heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT xuelongzhang heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT rongweiguan heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT guohuaji heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT jingbai heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT fengchen heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT yongliu heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT wenjingsun heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily AT songbinfu heterozygousduplicationvariantofthehoxd13genecausedsynpolydactylytype1withvariableexpressivityinachinesefamily |