Molecular Study on The Pathogenicity of Avian Influenza Virus
Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) based<br />on multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose of<br />this work was toamplify and sequence the cleavage site...
| Main Authors: | , , , , |
|---|---|
| Format: | Article |
| Language: | English |
| Published: |
Universitas Gadjah Mada, Yogyakarta
2015-10-01
|
| Series: | Indonesian Journal of Biotechnology |
| Online Access: | http://journal.ugm.ac.id/ijbiotech/article/view/7567 |
| Summary: | Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) based<br />on multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose of<br />this work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from both<br />cases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primer<br />desaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-<br />R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenza<br />virus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic amino<br />acid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HA<br />genefragment indicated that each type of characteristic lesion created philo-groups.<br />Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny. |
|---|---|
| ISSN: | 0853-8654 2089-2241 |