Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families
Abstract Background β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. Results In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (t...
| Main Authors: | , , , , , , , , , , |
|---|---|
| Format: | Article |
| Language: | English |
| Published: |
BMC
2023-12-01
|
| Series: | Human Genomics |
| Subjects: | |
| Online Access: | https://doi.org/10.1186/s40246-023-00559-4 |
| _version_ | 1797397866018242560 |
|---|---|
| author | Xiuqin Bao Danqing Qin Jicheng Wang Jing Chen Cuize Yao Jie Liang Kailing Liang Yixia Wang Yousheng Wang Li Du Aihua Yin |
| author_facet | Xiuqin Bao Danqing Qin Jicheng Wang Jing Chen Cuize Yao Jie Liang Kailing Liang Yixia Wang Yousheng Wang Li Du Aihua Yin |
| author_sort | Xiuqin Bao |
| collection | DOAJ |
| description | Abstract Background β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. Results In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Conclusion Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis. |
| first_indexed | 2024-03-09T01:16:25Z |
| format | Article |
| id | doaj.art-409a8ace333143a18f88cc9920f25a84 |
| institution | Directory Open Access Journal |
| issn | 1479-7364 |
| language | English |
| last_indexed | 2024-03-09T01:16:25Z |
| publishDate | 2023-12-01 |
| publisher | BMC |
| record_format | Article |
| series | Human Genomics |
| spelling | doaj.art-409a8ace333143a18f88cc9920f25a842023-12-10T12:25:39ZengBMCHuman Genomics1479-73642023-12-011711510.1186/s40246-023-00559-4Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese familiesXiuqin Bao0Danqing Qin1Jicheng Wang2Jing Chen3Cuize Yao4Jie Liang5Kailing Liang6Yixia Wang7Yousheng Wang8Li Du9Aihua Yin10Medical Genetic Center, Guangdong Women and Children HospitalMedical Genetic Center, Guangdong Women and Children HospitalMedical Genetic Center, Guangdong Women and Children HospitalPrenatal Diagnosis Center, The Second People’s Hospital of ZhaoqingMedical Genetic Center, Guangdong Women and Children HospitalMedical Genetic Center, Guangdong Women and Children HospitalMedical Genetic Center, Guangdong Women and Children HospitalMedical Genetic Center, Guangdong Women and Children HospitalGrassroots Guidance and Collaboration Section, Guangdong Women and Children HospitalMedical Genetic Center, Guangdong Women and Children HospitalMedical Genetic Center, Guangdong Women and Children HospitalAbstract Background β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. Results In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Conclusion Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.https://doi.org/10.1186/s40246-023-00559-4β-ThalassemiaNovel mutationsβ-Thalassemia traitPremature terminationTruncated peptide |
| spellingShingle | Xiuqin Bao Danqing Qin Jicheng Wang Jing Chen Cuize Yao Jie Liang Kailing Liang Yixia Wang Yousheng Wang Li Du Aihua Yin Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families Human Genomics β-Thalassemia Novel mutations β-Thalassemia trait Premature termination Truncated peptide |
| title | Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families |
| title_full | Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families |
| title_fullStr | Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families |
| title_full_unstemmed | Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families |
| title_short | Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families |
| title_sort | two novel deletion mutations in β globin gene cause β thalassemia trait in two chinese families |
| topic | β-Thalassemia Novel mutations β-Thalassemia trait Premature termination Truncated peptide |
| url | https://doi.org/10.1186/s40246-023-00559-4 |
| work_keys_str_mv | AT xiuqinbao twonoveldeletionmutationsinbglobingenecausebthalassemiatraitintwochinesefamilies AT danqingqin twonoveldeletionmutationsinbglobingenecausebthalassemiatraitintwochinesefamilies AT jichengwang twonoveldeletionmutationsinbglobingenecausebthalassemiatraitintwochinesefamilies AT jingchen twonoveldeletionmutationsinbglobingenecausebthalassemiatraitintwochinesefamilies AT cuizeyao twonoveldeletionmutationsinbglobingenecausebthalassemiatraitintwochinesefamilies AT jieliang twonoveldeletionmutationsinbglobingenecausebthalassemiatraitintwochinesefamilies AT kailingliang twonoveldeletionmutationsinbglobingenecausebthalassemiatraitintwochinesefamilies AT yixiawang twonoveldeletionmutationsinbglobingenecausebthalassemiatraitintwochinesefamilies AT youshengwang twonoveldeletionmutationsinbglobingenecausebthalassemiatraitintwochinesefamilies AT lidu twonoveldeletionmutationsinbglobingenecausebthalassemiatraitintwochinesefamilies AT aihuayin twonoveldeletionmutationsinbglobingenecausebthalassemiatraitintwochinesefamilies |