Serotype Specific Sequence for Multi Test Line Nucleic Acid Lateral Flow Development
Dengue virus that causes dengue fever and dengue shock syndrome has 4 different serotypes. Serotyping is needed for diagnosing and surveillance activities of disease spreaders. Recently, the Nucleic Acid Lateral Flow (NALF) method has been developed to confirm the results of easy amplification witho...
| Main Authors: | , , , |
|---|---|
| Format: | Article |
| Language: | Indonesian |
| Published: |
Universitas Gadjah Mada
2021-12-01
|
| Series: | Jurnal Sain Veteriner |
| Subjects: | |
| Online Access: | https://journal.ugm.ac.id/jsv/article/view/44696 |
| _version_ | 1827941510585253888 |
|---|---|
| author | Narendra Yoga Hendarta Asmarani Kusumawati Tri Wibawa Abu Tholib Aman |
| author_facet | Narendra Yoga Hendarta Asmarani Kusumawati Tri Wibawa Abu Tholib Aman |
| author_sort | Narendra Yoga Hendarta |
| collection | DOAJ |
| description | Dengue virus that causes dengue fever and dengue shock syndrome has 4 different serotypes. Serotyping is needed for diagnosing and surveillance activities of disease spreaders. Recently, the Nucleic Acid Lateral Flow (NALF) method has been developed to confirm the results of easy amplification without complicated equipment. The aim of this study was designing capture probe for serotyping dengue virus (DENV) using NALF method. We have conducted an analytical study to obtain four specific sequences of Dengue Virus serotypes to develop serotipe specific NALF. Several parameters were used to analyzed Dengue genome sequences i.e % GC content, target homology, length of 100% homology continue of non-specific bases, hybridization temperature, and secondary structure to estimate the probe's capture capability in the hybridization reaction. The capture probes were applied to NALF and assayed using single strand DNA sample to check its performance. The result of four specific sequence capture probes, DENV1, 2, 3, 4 were CACCAGGGGAAGCTGTACCCTGGTGGT, GTGAGATGAAGCTGTAGTCTCACTGG, GCACTGAGGGAAGCTGTACCTCCTTGCA, AGCCAGGAGGAAGCTGTACTTCTGGTGG. Application to fabricated NALF gave no cross hybridization with high stringency buffer assay.
Keywords : capture probe; dengue virus; hybridization; nucleic acid lateral flow; serotyping |
| first_indexed | 2024-03-13T09:39:24Z |
| format | Article |
| id | doaj.art-47519679d4564d3a82945e7480027adc |
| institution | Directory Open Access Journal |
| issn | 2407-3733 |
| language | Indonesian |
| last_indexed | 2024-03-13T09:39:24Z |
| publishDate | 2021-12-01 |
| publisher | Universitas Gadjah Mada |
| record_format | Article |
| series | Jurnal Sain Veteriner |
| spelling | doaj.art-47519679d4564d3a82945e7480027adc2023-05-25T04:55:23ZindUniversitas Gadjah MadaJurnal Sain Veteriner2407-37332021-12-0139320721510.22146/jsv.4469631106Serotype Specific Sequence for Multi Test Line Nucleic Acid Lateral Flow DevelopmentNarendra Yoga Hendarta0Asmarani Kusumawati1Tri Wibawa2Abu Tholib Aman3Department of Medical Laboratory Technology, Politeknik Kesehatan Kementerian Kesehatan YogyakartaDepartment of Reproduction and Obstetrics, Faculty of Veterinary Medicine, Universitas Gadjah MadaDepartment of Microbiology, Faculty of Medicine, Public Health and Nursing, Universitas Gadjah MadaDepartment of Microbiology, Faculty of Medicine, Public Health and Nursing, Universitas Gadjah MadaDengue virus that causes dengue fever and dengue shock syndrome has 4 different serotypes. Serotyping is needed for diagnosing and surveillance activities of disease spreaders. Recently, the Nucleic Acid Lateral Flow (NALF) method has been developed to confirm the results of easy amplification without complicated equipment. The aim of this study was designing capture probe for serotyping dengue virus (DENV) using NALF method. We have conducted an analytical study to obtain four specific sequences of Dengue Virus serotypes to develop serotipe specific NALF. Several parameters were used to analyzed Dengue genome sequences i.e % GC content, target homology, length of 100% homology continue of non-specific bases, hybridization temperature, and secondary structure to estimate the probe's capture capability in the hybridization reaction. The capture probes were applied to NALF and assayed using single strand DNA sample to check its performance. The result of four specific sequence capture probes, DENV1, 2, 3, 4 were CACCAGGGGAAGCTGTACCCTGGTGGT, GTGAGATGAAGCTGTAGTCTCACTGG, GCACTGAGGGAAGCTGTACCTCCTTGCA, AGCCAGGAGGAAGCTGTACTTCTGGTGG. Application to fabricated NALF gave no cross hybridization with high stringency buffer assay. Keywords : capture probe; dengue virus; hybridization; nucleic acid lateral flow; serotypinghttps://journal.ugm.ac.id/jsv/article/view/44696capture probedengue virushybridizationnucleic acid lateral flowserotyping |
| spellingShingle | Narendra Yoga Hendarta Asmarani Kusumawati Tri Wibawa Abu Tholib Aman Serotype Specific Sequence for Multi Test Line Nucleic Acid Lateral Flow Development Jurnal Sain Veteriner capture probe dengue virus hybridization nucleic acid lateral flow serotyping |
| title | Serotype Specific Sequence for Multi Test Line Nucleic Acid Lateral Flow Development |
| title_full | Serotype Specific Sequence for Multi Test Line Nucleic Acid Lateral Flow Development |
| title_fullStr | Serotype Specific Sequence for Multi Test Line Nucleic Acid Lateral Flow Development |
| title_full_unstemmed | Serotype Specific Sequence for Multi Test Line Nucleic Acid Lateral Flow Development |
| title_short | Serotype Specific Sequence for Multi Test Line Nucleic Acid Lateral Flow Development |
| title_sort | serotype specific sequence for multi test line nucleic acid lateral flow development |
| topic | capture probe dengue virus hybridization nucleic acid lateral flow serotyping |
| url | https://journal.ugm.ac.id/jsv/article/view/44696 |
| work_keys_str_mv | AT narendrayogahendarta serotypespecificsequenceformultitestlinenucleicacidlateralflowdevelopment AT asmaranikusumawati serotypespecificsequenceformultitestlinenucleicacidlateralflowdevelopment AT triwibawa serotypespecificsequenceformultitestlinenucleicacidlateralflowdevelopment AT abutholibaman serotypespecificsequenceformultitestlinenucleicacidlateralflowdevelopment |