Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis
Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung’s disease. WS is clinically and genetically heterogeneous and it is classified into four ma...
| Main Authors: | , , , , , , , , , , |
|---|---|
| Format: | Article |
| Language: | English |
| Published: |
Frontiers Media S.A.
2020-12-01
|
| Series: | Frontiers in Genetics |
| Subjects: | |
| Online Access: | https://www.frontiersin.org/articles/10.3389/fgene.2020.589784/full |
| _version_ | 1818730598615744512 |
|---|---|
| author | Supranee Thongpradit Natini Jinawath Natini Jinawath Asif Javed Asif Javed Laran T. Jensen Issarapa Chunsuwan Kitiwan Rojnueangnit Thipwimol Tim-Aroon Krisna Lertsukprasert Meng-Shin Shiao Nongnuch Sirachainan Duangrurdee Wattanasirichaigoon |
| author_facet | Supranee Thongpradit Natini Jinawath Natini Jinawath Asif Javed Asif Javed Laran T. Jensen Issarapa Chunsuwan Kitiwan Rojnueangnit Thipwimol Tim-Aroon Krisna Lertsukprasert Meng-Shin Shiao Nongnuch Sirachainan Duangrurdee Wattanasirichaigoon |
| author_sort | Supranee Thongpradit |
| collection | DOAJ |
| description | Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung’s disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung’s disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung’s disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype–phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype–phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations. |
| first_indexed | 2024-12-17T23:04:20Z |
| format | Article |
| id | doaj.art-53b6c9228f814e8abb18667953e586ef |
| institution | Directory Open Access Journal |
| issn | 1664-8021 |
| language | English |
| last_indexed | 2024-12-17T23:04:20Z |
| publishDate | 2020-12-01 |
| publisher | Frontiers Media S.A. |
| record_format | Article |
| series | Frontiers in Genetics |
| spelling | doaj.art-53b6c9228f814e8abb18667953e586ef2022-12-21T21:29:19ZengFrontiers Media S.A.Frontiers in Genetics1664-80212020-12-011110.3389/fgene.2020.589784589784Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype AnalysisSupranee Thongpradit0Natini Jinawath1Natini Jinawath2Asif Javed3Asif Javed4Laran T. Jensen5Issarapa Chunsuwan6Kitiwan Rojnueangnit7Thipwimol Tim-Aroon8Krisna Lertsukprasert9Meng-Shin Shiao10Nongnuch Sirachainan11Duangrurdee Wattanasirichaigoon12Research Center, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, ThailandProgram in Translational Medicine, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, ThailandIntegrative Computational BioScience Center (ICBS), Mahidol University, Salaya, ThailandComputational and Systems Biology Group, Genome Institute of Singapore, Agency for Science, Technology and Research, Singapore, SingaporeSchool of Biomedical Sciences, University of Hong Kong, Hong Kong, ChinaDepartment of Biochemistry, Faculty of Science, Mahidol University, Bangkok, ThailandDepartment of Pediatrics, Faculty of Medicine, Thammasat University, Pathumthani, ThailandDepartment of Pediatrics, Faculty of Medicine, Thammasat University, Pathumthani, ThailandDivision of Medical Genetics, Department of Pediatrics, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, ThailandDepartment of Communication Sciences and Disorders, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, ThailandResearch Center, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, Thailand0Division of Hematology and Oncology, Department of Pediatrics, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, ThailandDivision of Medical Genetics, Department of Pediatrics, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, ThailandWaardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung’s disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung’s disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung’s disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype–phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype–phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.https://www.frontiersin.org/articles/10.3389/fgene.2020.589784/fullSOX10Waardenburg syndromegenotype-phenotype analysisHirschsprung’s diseaseplatelet dysfunctionplatelet storage pool defect |
| spellingShingle | Supranee Thongpradit Natini Jinawath Natini Jinawath Asif Javed Asif Javed Laran T. Jensen Issarapa Chunsuwan Kitiwan Rojnueangnit Thipwimol Tim-Aroon Krisna Lertsukprasert Meng-Shin Shiao Nongnuch Sirachainan Duangrurdee Wattanasirichaigoon Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis Frontiers in Genetics SOX10 Waardenburg syndrome genotype-phenotype analysis Hirschsprung’s disease platelet dysfunction platelet storage pool defect |
| title | Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis |
| title_full | Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis |
| title_fullStr | Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis |
| title_full_unstemmed | Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis |
| title_short | Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis |
| title_sort | novel sox10 mutations in waardenburg syndrome functional characterization and genotype phenotype analysis |
| topic | SOX10 Waardenburg syndrome genotype-phenotype analysis Hirschsprung’s disease platelet dysfunction platelet storage pool defect |
| url | https://www.frontiersin.org/articles/10.3389/fgene.2020.589784/full |
| work_keys_str_mv | AT supraneethongpradit novelsox10mutationsinwaardenburgsyndromefunctionalcharacterizationandgenotypephenotypeanalysis AT natinijinawath novelsox10mutationsinwaardenburgsyndromefunctionalcharacterizationandgenotypephenotypeanalysis AT natinijinawath novelsox10mutationsinwaardenburgsyndromefunctionalcharacterizationandgenotypephenotypeanalysis AT asifjaved novelsox10mutationsinwaardenburgsyndromefunctionalcharacterizationandgenotypephenotypeanalysis AT asifjaved novelsox10mutationsinwaardenburgsyndromefunctionalcharacterizationandgenotypephenotypeanalysis AT larantjensen novelsox10mutationsinwaardenburgsyndromefunctionalcharacterizationandgenotypephenotypeanalysis AT issarapachunsuwan novelsox10mutationsinwaardenburgsyndromefunctionalcharacterizationandgenotypephenotypeanalysis AT kitiwanrojnueangnit novelsox10mutationsinwaardenburgsyndromefunctionalcharacterizationandgenotypephenotypeanalysis AT thipwimoltimaroon novelsox10mutationsinwaardenburgsyndromefunctionalcharacterizationandgenotypephenotypeanalysis AT krisnalertsukprasert novelsox10mutationsinwaardenburgsyndromefunctionalcharacterizationandgenotypephenotypeanalysis AT mengshinshiao novelsox10mutationsinwaardenburgsyndromefunctionalcharacterizationandgenotypephenotypeanalysis AT nongnuchsirachainan novelsox10mutationsinwaardenburgsyndromefunctionalcharacterizationandgenotypephenotypeanalysis AT duangrurdeewattanasirichaigoon novelsox10mutationsinwaardenburgsyndromefunctionalcharacterizationandgenotypephenotypeanalysis |