Assessing Minimal Concentration of Toxoplasma Gondii B1 and P30 Gen Which Are Still Detectable By Polymerase Reaction Chain
Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. A serological test (ELISA) for detecting the presence of IgG and IgM antibodies against T.gondii is usually performed nowadays, however this serological test is not adequate. Therefore an accurate laboratory test is needed f...
| Main Authors: | , , |
|---|---|
| Format: | Article |
| Language: | English |
| Published: |
Universitas Indonesia
2010-10-01
|
| Series: | Makara Journal of Health Research |
| Subjects: | |
| Online Access: | http://journal.ui.ac.id/index.php/health/article/view/80 |
| _version_ | 1797726850015821824 |
|---|---|
| author | Lisawati Susanto Taniawati Supali Srisasi Gandahusada |
| author_facet | Lisawati Susanto Taniawati Supali Srisasi Gandahusada |
| author_sort | Lisawati Susanto |
| collection | DOAJ |
| description | Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. A serological test (ELISA) for detecting the presence of IgG and IgM antibodies against T.gondii is usually performed nowadays, however this serological test is not adequate. Therefore an accurate laboratory test is needed for diagnosing acute toxoplasmosis, and in this case the polymerase chain reaction (PCR) is the method of choice. The aim of this study is to assess the minimal concentration of the DNA of T.gondii which still can be detected by the PCR using B1 and P30 genes as targets. The PCR against B1 gene as target was performed by using the method described by Chang and Ho. Two methods described by Weiss et al and Chang Ho were used against P30 gene as target. The B1 gene primers consisted of oligo 1 :5' GGAACTGCATCCGTTCAGA G3 and oligo 2 : 5'TCTTTAAAGCGTTCGTGGTC3, whereas the P30 gene primers consisted of oligo 1 : 5'CACACGGTTGTATGTCGGTTTCG CT3 and oligo 2 : 5'TCAAGG AGCTCAAT GTTACAGCCT3. It was shown that no specific bands were observed in the PCR with P30 gene as target using the method by Weiss et al. With the method Chang Ho the electrophoresis did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. It was concluded that the assay using B1 gene as target was more sensitive than the one using P30 gene as target. |
| first_indexed | 2024-03-12T10:51:26Z |
| format | Article |
| id | doaj.art-5d08feb287f14cb18016ea4df0ac4037 |
| institution | Directory Open Access Journal |
| issn | 2356-3664 2356-3656 |
| language | English |
| last_indexed | 2024-03-12T10:51:26Z |
| publishDate | 2010-10-01 |
| publisher | Universitas Indonesia |
| record_format | Article |
| series | Makara Journal of Health Research |
| spelling | doaj.art-5d08feb287f14cb18016ea4df0ac40372023-09-02T06:53:19ZengUniversitas IndonesiaMakara Journal of Health Research2356-36642356-36562010-10-0162646910.7454/msk.v6i2.8078Assessing Minimal Concentration of Toxoplasma Gondii B1 and P30 Gen Which Are Still Detectable By Polymerase Reaction ChainLisawati Susanto0Taniawati Supali1Srisasi Gandahusada2Department of Parasitology, Faculty of Medicine, Universitas Indonesia, Jl. Salemba Raya No. 6, Jakarta 10430Department of Parasitology, Faculty of Medicine, Universitas Indonesia, Jl. Salemba Raya No. 6, Jakarta 10430Department of Parasitology, Faculty of Medicine, Universitas Indonesia, Jl. Salemba Raya No. 6, Jakarta 10430Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. A serological test (ELISA) for detecting the presence of IgG and IgM antibodies against T.gondii is usually performed nowadays, however this serological test is not adequate. Therefore an accurate laboratory test is needed for diagnosing acute toxoplasmosis, and in this case the polymerase chain reaction (PCR) is the method of choice. The aim of this study is to assess the minimal concentration of the DNA of T.gondii which still can be detected by the PCR using B1 and P30 genes as targets. The PCR against B1 gene as target was performed by using the method described by Chang and Ho. Two methods described by Weiss et al and Chang Ho were used against P30 gene as target. The B1 gene primers consisted of oligo 1 :5' GGAACTGCATCCGTTCAGA G3 and oligo 2 : 5'TCTTTAAAGCGTTCGTGGTC3, whereas the P30 gene primers consisted of oligo 1 : 5'CACACGGTTGTATGTCGGTTTCG CT3 and oligo 2 : 5'TCAAGG AGCTCAAT GTTACAGCCT3. It was shown that no specific bands were observed in the PCR with P30 gene as target using the method by Weiss et al. With the method Chang Ho the electrophoresis did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. It was concluded that the assay using B1 gene as target was more sensitive than the one using P30 gene as target.http://journal.ui.ac.id/index.php/health/article/view/80Toxoplasma gondiiB1 geneP30 genePCR |
| spellingShingle | Lisawati Susanto Taniawati Supali Srisasi Gandahusada Assessing Minimal Concentration of Toxoplasma Gondii B1 and P30 Gen Which Are Still Detectable By Polymerase Reaction Chain Makara Journal of Health Research Toxoplasma gondii B1 gene P30 gene PCR |
| title | Assessing Minimal Concentration of Toxoplasma Gondii B1 and P30 Gen Which Are Still Detectable By Polymerase Reaction Chain |
| title_full | Assessing Minimal Concentration of Toxoplasma Gondii B1 and P30 Gen Which Are Still Detectable By Polymerase Reaction Chain |
| title_fullStr | Assessing Minimal Concentration of Toxoplasma Gondii B1 and P30 Gen Which Are Still Detectable By Polymerase Reaction Chain |
| title_full_unstemmed | Assessing Minimal Concentration of Toxoplasma Gondii B1 and P30 Gen Which Are Still Detectable By Polymerase Reaction Chain |
| title_short | Assessing Minimal Concentration of Toxoplasma Gondii B1 and P30 Gen Which Are Still Detectable By Polymerase Reaction Chain |
| title_sort | assessing minimal concentration of toxoplasma gondii b1 and p30 gen which are still detectable by polymerase reaction chain |
| topic | Toxoplasma gondii B1 gene P30 gene PCR |
| url | http://journal.ui.ac.id/index.php/health/article/view/80 |
| work_keys_str_mv | AT lisawatisusanto assessingminimalconcentrationoftoxoplasmagondiib1andp30genwhicharestilldetectablebypolymerasereactionchain AT taniawatisupali assessingminimalconcentrationoftoxoplasmagondiib1andp30genwhicharestilldetectablebypolymerasereactionchain AT srisasigandahusada assessingminimalconcentrationoftoxoplasmagondiib1andp30genwhicharestilldetectablebypolymerasereactionchain |