Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium Chloride
This study aims to determine the profile of the ABC2 encoding transporter on Trypanosoma evansi (T. evansi) Ngawi isolates, Indonesia, exposed with Isometamidium Chloride (ISM). This study used blood samples of mice containing Trypanosoma evansi that had been exposed with ISM 0.05 mg/kg BW, ISM 0.1...
| Main Authors: | , , , , |
|---|---|
| Format: | Article |
| Language: | English |
| Published: |
EDP Sciences
2021-01-01
|
| Series: | BIO Web of Conferences |
| Subjects: | |
| Online Access: | https://www.bio-conferences.org/articles/bioconf/pdf/2021/13/bioconf_biomic2021_06003.pdf |
| _version_ | 1819279120676159488 |
|---|---|
| author | Wusahaningtyas Lu’lu’ Sahara Nuryady Moh Mirza Firdausy Lintang Winantya Fahrurrozi Zs Ahmad Nurcahyo R. Wisnu |
| author_facet | Wusahaningtyas Lu’lu’ Sahara Nuryady Moh Mirza Firdausy Lintang Winantya Fahrurrozi Zs Ahmad Nurcahyo R. Wisnu |
| author_sort | Wusahaningtyas Lu’lu’ Sahara |
| collection | DOAJ |
| description | This study aims to determine the profile of the ABC2 encoding transporter on Trypanosoma evansi (T. evansi) Ngawi isolates, Indonesia, exposed with Isometamidium Chloride (ISM). This study used blood samples of mice containing Trypanosoma evansi that had been exposed with ISM 0.05 mg/kg BW, ISM 0.1 mg/kg BW and ISM 0.3 mg/kg BW for 4 weeks, and control group. Blood samples were extracted and amplified using primers. ABC2 F 5 ’GCTTGTCCGACCATCTTGCA 3’ and ABC2 R 5 ’AGGTCCACTCCCATGCTACA 3’ that produced 350 basepairs (bp). The sequencing results were then analyzed using BLAST and MEGA 7.0. There was 1 deference nucleotide (107) derived from multiple alignments, while in amino acids there was no difference in all samples. Trypanosoma evansi which was exposed with ISM does not have many differences in nucleotide or amino acid and only one type of mutation. The ABC2 Transporters of four groups of T.evansi have high similarity to ABC Transporters of T. brucei gambiense, T. brucei brucei, and T. brucei brucei (Tbabc2). Therefore, further research on the ABC2 Transporter gene is needed. |
| first_indexed | 2024-12-24T00:22:51Z |
| format | Article |
| id | doaj.art-69dc6d7eb4b046e8af72a675678f3862 |
| institution | Directory Open Access Journal |
| issn | 2117-4458 |
| language | English |
| last_indexed | 2024-12-24T00:22:51Z |
| publishDate | 2021-01-01 |
| publisher | EDP Sciences |
| record_format | Article |
| series | BIO Web of Conferences |
| spelling | doaj.art-69dc6d7eb4b046e8af72a675678f38622022-12-21T17:24:32ZengEDP SciencesBIO Web of Conferences2117-44582021-01-01410600310.1051/bioconf/20214106003bioconf_biomic2021_06003Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium ChlorideWusahaningtyas Lu’lu’ Sahara0Nuryady Moh Mirza1Firdausy Lintang Winantya2Fahrurrozi Zs Ahmad3Nurcahyo R. Wisnu4Master Program of Sain Veteriner, Faculty of Veterinary Medicine, Universitas Gadjah MadaMaster Program of Sain Veteriner, Faculty of Veterinary Medicine, Universitas Gadjah MadaMaster Program of Sain Veteriner, Faculty of Veterinary Medicine, Universitas Gadjah MadaTropical Medicine, Medicine Faculty, Universitas Gadjah MadaDepartement of Parasitology, Faculty of Veterinary Medicine, Universitas Gadjah Mada.This study aims to determine the profile of the ABC2 encoding transporter on Trypanosoma evansi (T. evansi) Ngawi isolates, Indonesia, exposed with Isometamidium Chloride (ISM). This study used blood samples of mice containing Trypanosoma evansi that had been exposed with ISM 0.05 mg/kg BW, ISM 0.1 mg/kg BW and ISM 0.3 mg/kg BW for 4 weeks, and control group. Blood samples were extracted and amplified using primers. ABC2 F 5 ’GCTTGTCCGACCATCTTGCA 3’ and ABC2 R 5 ’AGGTCCACTCCCATGCTACA 3’ that produced 350 basepairs (bp). The sequencing results were then analyzed using BLAST and MEGA 7.0. There was 1 deference nucleotide (107) derived from multiple alignments, while in amino acids there was no difference in all samples. Trypanosoma evansi which was exposed with ISM does not have many differences in nucleotide or amino acid and only one type of mutation. The ABC2 Transporters of four groups of T.evansi have high similarity to ABC Transporters of T. brucei gambiense, T. brucei brucei, and T. brucei brucei (Tbabc2). Therefore, further research on the ABC2 Transporter gene is needed.https://www.bio-conferences.org/articles/bioconf/pdf/2021/13/bioconf_biomic2021_06003.pdfabc2 transporter genetrypanosoma evansiisometamidium chlorideresista nce |
| spellingShingle | Wusahaningtyas Lu’lu’ Sahara Nuryady Moh Mirza Firdausy Lintang Winantya Fahrurrozi Zs Ahmad Nurcahyo R. Wisnu Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium Chloride BIO Web of Conferences abc2 transporter gene trypanosoma evansi isometamidium chloride resista nce |
| title | Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium Chloride |
| title_full | Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium Chloride |
| title_fullStr | Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium Chloride |
| title_full_unstemmed | Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium Chloride |
| title_short | Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium Chloride |
| title_sort | molecular identification of abc2 transporter gene encode protein ngawi trypanosoma evansi isolate that suspected resistance to isometamidium chloride |
| topic | abc2 transporter gene trypanosoma evansi isometamidium chloride resista nce |
| url | https://www.bio-conferences.org/articles/bioconf/pdf/2021/13/bioconf_biomic2021_06003.pdf |
| work_keys_str_mv | AT wusahaningtyaslulusahara molecularidentificationofabc2transportergeneencodeproteinngawitrypanosomaevansiisolatethatsuspectedresistancetoisometamidiumchloride AT nuryadymohmirza molecularidentificationofabc2transportergeneencodeproteinngawitrypanosomaevansiisolatethatsuspectedresistancetoisometamidiumchloride AT firdausylintangwinantya molecularidentificationofabc2transportergeneencodeproteinngawitrypanosomaevansiisolatethatsuspectedresistancetoisometamidiumchloride AT fahrurrozizsahmad molecularidentificationofabc2transportergeneencodeproteinngawitrypanosomaevansiisolatethatsuspectedresistancetoisometamidiumchloride AT nurcahyorwisnu molecularidentificationofabc2transportergeneencodeproteinngawitrypanosomaevansiisolatethatsuspectedresistancetoisometamidiumchloride |