Indels within the bovine visfatin gene affect its mRNA expression in longissimus muscle and subcutaneous fat
Visfatin, an adipokine hormone produced primarily by visceral adipose tissue in mammals, has been identified as having a crucial role in growth and development of skeletal muscle and lipids. In this research, the effects of two indel loci (35 bp indel: AC_000161.1: g. 20540–20541 Ins ACTGG...
Main Authors: | , , , , , |
---|---|
Format: | Article |
Language: | English |
Published: |
Copernicus Publications
2016-02-01
|
Series: | Archives Animal Breeding |
Online Access: | http://www.arch-anim-breed.net/59/91/2016/aab-59-91-2016.pdf |
_version_ | 1819263569183637504 |
---|---|
author | H. Cai Z. Wang X. Lan Y. Xu H. Chen C. Lei |
author_facet | H. Cai Z. Wang X. Lan Y. Xu H. Chen C. Lei |
author_sort | H. Cai |
collection | DOAJ |
description | Visfatin, an adipokine hormone produced primarily by visceral adipose tissue
in mammals, has been identified as having a crucial role in growth and development
of skeletal muscle and lipids. In this research, the effects of two indel
loci (35 bp indel: AC_000161.1: g. 20540–20541 Ins
ACTGGAATTCTAGTTTAAAAATTGCTACTAATGAA located in intron 4; 6 bp indel:
AC_000161.1: g. 25873–25878 Del: TAAAAA located in intron 5)
of the visfatin gene on mRNA expression levels were studied by means of real-time quantitative
PCR (qPCR) in longissimus muscle and subcutaneous fat from 95 Qinchuan
cattle. Firstly, visfatin expression level in longissimus muscle of fetal cattle was
prominently greater than that in calves and adult cattle (<i>P</i> < 0.05).
The expression level of visfatin in subcutaneous fat was notably higher than that in
longissimus muscle of calves and adult cattle (<i>P</i> < 0.05). Secondly,
there were three genotypes (ins/ins, del/del and ins/del) and two genotypes
(ins/del and ins/ins) detected in the 35 bp locus and 6 bp locus, respectively.
Visfatin showed a minimum expression level in longissimus muscle in the homozygous
deletion genotype at the 35 bp indel locus. Especially in calves, expression of
visfatin was significantly greater in the heterozygous genotype than that in
the homozygous insertion genotpye (<i>P</i> < 0.05). No statistical
differences were found among visfatin expression level based on genotypes in the 6 bp
indel locus (<i>P</i> > 0.05). Compared to heterozygous genotype, the
expression level of homozygous insertion genotype was lower in longissimus
muscle but greater in subcutaneous fat. These results imply that the
expression levels of bovine visfatin vary with age and its indels might be
putative variants mediating the expression of the bovine visfatin gene. This study provides useful information for further functional studies of bovine
visfatin. |
first_indexed | 2024-12-23T20:15:40Z |
format | Article |
id | doaj.art-7985393859204671a8b9e8826bc80f4b |
institution | Directory Open Access Journal |
issn | 0003-9438 2363-9822 |
language | English |
last_indexed | 2024-12-23T20:15:40Z |
publishDate | 2016-02-01 |
publisher | Copernicus Publications |
record_format | Article |
series | Archives Animal Breeding |
spelling | doaj.art-7985393859204671a8b9e8826bc80f4b2022-12-21T17:32:42ZengCopernicus PublicationsArchives Animal Breeding0003-94382363-98222016-02-01591919510.5194/aab-59-91-2016Indels within the bovine visfatin gene affect its mRNA expression in longissimus muscle and subcutaneous fatH. Cai0Z. Wang1X. Lan2Y. Xu3H. Chen4C. Lei5College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi, 712100, ChinaCollege of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi, 712100, ChinaCollege of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi, 712100, ChinaCollege of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi, 712100, ChinaCollege of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi, 712100, ChinaCollege of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi, 712100, ChinaVisfatin, an adipokine hormone produced primarily by visceral adipose tissue in mammals, has been identified as having a crucial role in growth and development of skeletal muscle and lipids. In this research, the effects of two indel loci (35 bp indel: AC_000161.1: g. 20540–20541 Ins ACTGGAATTCTAGTTTAAAAATTGCTACTAATGAA located in intron 4; 6 bp indel: AC_000161.1: g. 25873–25878 Del: TAAAAA located in intron 5) of the visfatin gene on mRNA expression levels were studied by means of real-time quantitative PCR (qPCR) in longissimus muscle and subcutaneous fat from 95 Qinchuan cattle. Firstly, visfatin expression level in longissimus muscle of fetal cattle was prominently greater than that in calves and adult cattle (<i>P</i> < 0.05). The expression level of visfatin in subcutaneous fat was notably higher than that in longissimus muscle of calves and adult cattle (<i>P</i> < 0.05). Secondly, there were three genotypes (ins/ins, del/del and ins/del) and two genotypes (ins/del and ins/ins) detected in the 35 bp locus and 6 bp locus, respectively. Visfatin showed a minimum expression level in longissimus muscle in the homozygous deletion genotype at the 35 bp indel locus. Especially in calves, expression of visfatin was significantly greater in the heterozygous genotype than that in the homozygous insertion genotpye (<i>P</i> < 0.05). No statistical differences were found among visfatin expression level based on genotypes in the 6 bp indel locus (<i>P</i> > 0.05). Compared to heterozygous genotype, the expression level of homozygous insertion genotype was lower in longissimus muscle but greater in subcutaneous fat. These results imply that the expression levels of bovine visfatin vary with age and its indels might be putative variants mediating the expression of the bovine visfatin gene. This study provides useful information for further functional studies of bovine visfatin.http://www.arch-anim-breed.net/59/91/2016/aab-59-91-2016.pdf |
spellingShingle | H. Cai Z. Wang X. Lan Y. Xu H. Chen C. Lei Indels within the bovine visfatin gene affect its mRNA expression in longissimus muscle and subcutaneous fat Archives Animal Breeding |
title | Indels within the bovine visfatin gene affect its mRNA expression in longissimus muscle and subcutaneous fat |
title_full | Indels within the bovine visfatin gene affect its mRNA expression in longissimus muscle and subcutaneous fat |
title_fullStr | Indels within the bovine visfatin gene affect its mRNA expression in longissimus muscle and subcutaneous fat |
title_full_unstemmed | Indels within the bovine visfatin gene affect its mRNA expression in longissimus muscle and subcutaneous fat |
title_short | Indels within the bovine visfatin gene affect its mRNA expression in longissimus muscle and subcutaneous fat |
title_sort | indels within the bovine visfatin gene affect its mrna expression in longissimus muscle and subcutaneous fat |
url | http://www.arch-anim-breed.net/59/91/2016/aab-59-91-2016.pdf |
work_keys_str_mv | AT hcai indelswithinthebovinevisfatingeneaffectitsmrnaexpressioninlongissimusmuscleandsubcutaneousfat AT zwang indelswithinthebovinevisfatingeneaffectitsmrnaexpressioninlongissimusmuscleandsubcutaneousfat AT xlan indelswithinthebovinevisfatingeneaffectitsmrnaexpressioninlongissimusmuscleandsubcutaneousfat AT yxu indelswithinthebovinevisfatingeneaffectitsmrnaexpressioninlongissimusmuscleandsubcutaneousfat AT hchen indelswithinthebovinevisfatingeneaffectitsmrnaexpressioninlongissimusmuscleandsubcutaneousfat AT clei indelswithinthebovinevisfatingeneaffectitsmrnaexpressioninlongissimusmuscleandsubcutaneousfat |