| Summary: | <i>Ephedra</i> plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore <i>Ephedra</i> materials are strictly in supervision internationally. However, unlawful utilization of <i>Ephedra</i> herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring <i>Ephedra</i> ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within <i>Ephedra</i> were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve <i>Ephedra</i> species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing <i>Ephedra</i> herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to <i>Ephedra</i> and conserved within the genus. It can be successfully utilized for the detection of <i>Ephedra</i> components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of <i>Ephedra</i>-containing products.
|
|---|