Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of <i>Ephedra</i>-Containing Products
<i>Ephedra</i> plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore <i>Ephedra</i> materials are strictly in supervision internationally. However,...
| Main Authors: | , , , , |
|---|---|
| Format: | Article |
| Language: | English |
| Published: |
MDPI AG
2022-04-01
|
| Series: | Molecules |
| Subjects: | |
| Online Access: | https://www.mdpi.com/1420-3049/27/7/2342 |
| _version_ | 1797438322062131200 |
|---|---|
| author | Gang Wang Xuanjiao Bai Xiaochen Chen Ying Ren Jianping Han |
| author_facet | Gang Wang Xuanjiao Bai Xiaochen Chen Ying Ren Jianping Han |
| author_sort | Gang Wang |
| collection | DOAJ |
| description | <i>Ephedra</i> plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore <i>Ephedra</i> materials are strictly in supervision internationally. However, unlawful utilization of <i>Ephedra</i> herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring <i>Ephedra</i> ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within <i>Ephedra</i> were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve <i>Ephedra</i> species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing <i>Ephedra</i> herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to <i>Ephedra</i> and conserved within the genus. It can be successfully utilized for the detection of <i>Ephedra</i> components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of <i>Ephedra</i>-containing products. |
| first_indexed | 2024-03-09T11:35:59Z |
| format | Article |
| id | doaj.art-7bacebbfe55944dc8ae85c1756dac07f |
| institution | Directory Open Access Journal |
| issn | 1420-3049 |
| language | English |
| last_indexed | 2024-03-09T11:35:59Z |
| publishDate | 2022-04-01 |
| publisher | MDPI AG |
| record_format | Article |
| series | Molecules |
| spelling | doaj.art-7bacebbfe55944dc8ae85c1756dac07f2023-11-30T23:42:57ZengMDPI AGMolecules1420-30492022-04-01277234210.3390/molecules27072342Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of <i>Ephedra</i>-Containing ProductsGang Wang0Xuanjiao Bai1Xiaochen Chen2Ying Ren3Jianping Han4Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing 100193, ChinaInstitute of Medicinal Plant Development, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing 100193, ChinaInstitute of Medicinal Plant Development, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing 100193, ChinaInstitute of Medicinal Plant Development, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing 100193, ChinaInstitute of Medicinal Plant Development, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing 100193, China<i>Ephedra</i> plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore <i>Ephedra</i> materials are strictly in supervision internationally. However, unlawful utilization of <i>Ephedra</i> herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring <i>Ephedra</i> ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within <i>Ephedra</i> were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve <i>Ephedra</i> species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing <i>Ephedra</i> herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to <i>Ephedra</i> and conserved within the genus. It can be successfully utilized for the detection of <i>Ephedra</i> components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of <i>Ephedra</i>-containing products.https://www.mdpi.com/1420-3049/27/7/2342<i>Ephedra</i>ephedrine alkaloidsmethamphetaminesupervisionnucleotide signatureDNA barcoding |
| spellingShingle | Gang Wang Xuanjiao Bai Xiaochen Chen Ying Ren Jianping Han Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of <i>Ephedra</i>-Containing Products Molecules <i>Ephedra</i> ephedrine alkaloids methamphetamine supervision nucleotide signature DNA barcoding |
| title | Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of <i>Ephedra</i>-Containing Products |
| title_full | Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of <i>Ephedra</i>-Containing Products |
| title_fullStr | Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of <i>Ephedra</i>-Containing Products |
| title_full_unstemmed | Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of <i>Ephedra</i>-Containing Products |
| title_short | Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of <i>Ephedra</i>-Containing Products |
| title_sort | development of a genus universal nucleotide signature for the identification and supervision of i ephedra i containing products |
| topic | <i>Ephedra</i> ephedrine alkaloids methamphetamine supervision nucleotide signature DNA barcoding |
| url | https://www.mdpi.com/1420-3049/27/7/2342 |
| work_keys_str_mv | AT gangwang developmentofagenusuniversalnucleotidesignaturefortheidentificationandsupervisionofiephedraicontainingproducts AT xuanjiaobai developmentofagenusuniversalnucleotidesignaturefortheidentificationandsupervisionofiephedraicontainingproducts AT xiaochenchen developmentofagenusuniversalnucleotidesignaturefortheidentificationandsupervisionofiephedraicontainingproducts AT yingren developmentofagenusuniversalnucleotidesignaturefortheidentificationandsupervisionofiephedraicontainingproducts AT jianpinghan developmentofagenusuniversalnucleotidesignaturefortheidentificationandsupervisionofiephedraicontainingproducts |