Analysis of Xylose Operon from <i>Paenibacillus polymyxa</i> ATCC842 and Development of Tools for Gene Expression
With numerous industrial applications, <i>Paenibacillus polymyxa</i> has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in <i>P. polymyxa</i> have not been systematically investigated, genetic...
| Main Authors: | , , , , , , , , , |
|---|---|
| Format: | Article |
| Language: | English |
| Published: |
MDPI AG
2022-04-01
|
| Series: | International Journal of Molecular Sciences |
| Subjects: | |
| Online Access: | https://www.mdpi.com/1422-0067/23/9/5024 |
| _version_ | 1797504433973624832 |
|---|---|
| author | Zilong Wang Yakun Fang Yi Shi Yu Xin ZhengHua Gu Ting Yang Youran Li Zhongyang Ding Guiyang Shi Liang Zhang |
| author_facet | Zilong Wang Yakun Fang Yi Shi Yu Xin ZhengHua Gu Ting Yang Youran Li Zhongyang Ding Guiyang Shi Liang Zhang |
| author_sort | Zilong Wang |
| collection | DOAJ |
| description | With numerous industrial applications, <i>Paenibacillus polymyxa</i> has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in <i>P. polymyxa</i> have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was “ACTTAGTTTAAGCAATAGACAAAGT”, and this can be degenerated to “ACTTWGTTTAWSSNATAVACAAAGT” in <i>Paenibacillus</i> spp., which differs from that in the <i>Bacillus</i> spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter P<i>shuttle-09</i>. The eGFP fluorescence intensity assay indicated that both the modified and original P<i>shuttle-09</i> had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in <i>Paenibacillus</i> spp. that can dynamically regulate its gene circuit strength through xylose. |
| first_indexed | 2024-03-10T04:04:30Z |
| format | Article |
| id | doaj.art-9304969038674b7c868fe6d6783e3282 |
| institution | Directory Open Access Journal |
| issn | 1661-6596 1422-0067 |
| language | English |
| last_indexed | 2024-03-10T04:04:30Z |
| publishDate | 2022-04-01 |
| publisher | MDPI AG |
| record_format | Article |
| series | International Journal of Molecular Sciences |
| spelling | doaj.art-9304969038674b7c868fe6d6783e32822023-11-23T08:25:53ZengMDPI AGInternational Journal of Molecular Sciences1661-65961422-00672022-04-01239502410.3390/ijms23095024Analysis of Xylose Operon from <i>Paenibacillus polymyxa</i> ATCC842 and Development of Tools for Gene ExpressionZilong Wang0Yakun Fang1Yi Shi2Yu Xin3ZhengHua Gu4Ting Yang5Youran Li6Zhongyang Ding7Guiyang Shi8Liang Zhang9National Engineering Research Center for Cereal Fermentation and Food Biomanufacturing, Jiangnan University, Wuxi 214122, ChinaNational Engineering Research Center for Cereal Fermentation and Food Biomanufacturing, Jiangnan University, Wuxi 214122, ChinaNational Engineering Research Center for Cereal Fermentation and Food Biomanufacturing, Jiangnan University, Wuxi 214122, ChinaNational Engineering Research Center for Cereal Fermentation and Food Biomanufacturing, Jiangnan University, Wuxi 214122, ChinaNational Engineering Research Center for Cereal Fermentation and Food Biomanufacturing, Jiangnan University, Wuxi 214122, ChinaWuxi Food Safety Inspection and Test Center, Wuxi 214142, ChinaNational Engineering Research Center for Cereal Fermentation and Food Biomanufacturing, Jiangnan University, Wuxi 214122, ChinaNational Engineering Research Center for Cereal Fermentation and Food Biomanufacturing, Jiangnan University, Wuxi 214122, ChinaNational Engineering Research Center for Cereal Fermentation and Food Biomanufacturing, Jiangnan University, Wuxi 214122, ChinaNational Engineering Research Center for Cereal Fermentation and Food Biomanufacturing, Jiangnan University, Wuxi 214122, ChinaWith numerous industrial applications, <i>Paenibacillus polymyxa</i> has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in <i>P. polymyxa</i> have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was “ACTTAGTTTAAGCAATAGACAAAGT”, and this can be degenerated to “ACTTWGTTTAWSSNATAVACAAAGT” in <i>Paenibacillus</i> spp., which differs from that in the <i>Bacillus</i> spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter P<i>shuttle-09</i>. The eGFP fluorescence intensity assay indicated that both the modified and original P<i>shuttle-09</i> had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in <i>Paenibacillus</i> spp. that can dynamically regulate its gene circuit strength through xylose.https://www.mdpi.com/1422-0067/23/9/5024<i>Paenibacillus polymyxa</i>xylose operoninducible expression system |
| spellingShingle | Zilong Wang Yakun Fang Yi Shi Yu Xin ZhengHua Gu Ting Yang Youran Li Zhongyang Ding Guiyang Shi Liang Zhang Analysis of Xylose Operon from <i>Paenibacillus polymyxa</i> ATCC842 and Development of Tools for Gene Expression International Journal of Molecular Sciences <i>Paenibacillus polymyxa</i> xylose operon inducible expression system |
| title | Analysis of Xylose Operon from <i>Paenibacillus polymyxa</i> ATCC842 and Development of Tools for Gene Expression |
| title_full | Analysis of Xylose Operon from <i>Paenibacillus polymyxa</i> ATCC842 and Development of Tools for Gene Expression |
| title_fullStr | Analysis of Xylose Operon from <i>Paenibacillus polymyxa</i> ATCC842 and Development of Tools for Gene Expression |
| title_full_unstemmed | Analysis of Xylose Operon from <i>Paenibacillus polymyxa</i> ATCC842 and Development of Tools for Gene Expression |
| title_short | Analysis of Xylose Operon from <i>Paenibacillus polymyxa</i> ATCC842 and Development of Tools for Gene Expression |
| title_sort | analysis of xylose operon from i paenibacillus polymyxa i atcc842 and development of tools for gene expression |
| topic | <i>Paenibacillus polymyxa</i> xylose operon inducible expression system |
| url | https://www.mdpi.com/1422-0067/23/9/5024 |
| work_keys_str_mv | AT zilongwang analysisofxyloseoperonfromipaenibacilluspolymyxaiatcc842anddevelopmentoftoolsforgeneexpression AT yakunfang analysisofxyloseoperonfromipaenibacilluspolymyxaiatcc842anddevelopmentoftoolsforgeneexpression AT yishi analysisofxyloseoperonfromipaenibacilluspolymyxaiatcc842anddevelopmentoftoolsforgeneexpression AT yuxin analysisofxyloseoperonfromipaenibacilluspolymyxaiatcc842anddevelopmentoftoolsforgeneexpression AT zhenghuagu analysisofxyloseoperonfromipaenibacilluspolymyxaiatcc842anddevelopmentoftoolsforgeneexpression AT tingyang analysisofxyloseoperonfromipaenibacilluspolymyxaiatcc842anddevelopmentoftoolsforgeneexpression AT youranli analysisofxyloseoperonfromipaenibacilluspolymyxaiatcc842anddevelopmentoftoolsforgeneexpression AT zhongyangding analysisofxyloseoperonfromipaenibacilluspolymyxaiatcc842anddevelopmentoftoolsforgeneexpression AT guiyangshi analysisofxyloseoperonfromipaenibacilluspolymyxaiatcc842anddevelopmentoftoolsforgeneexpression AT liangzhang analysisofxyloseoperonfromipaenibacilluspolymyxaiatcc842anddevelopmentoftoolsforgeneexpression |