Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype–Phenotype: A Correlation Analysis
BackgroundThis study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients.MethodsWhole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by...
| Main Authors: | , , , , , , , , |
|---|---|
| Format: | Article |
| Language: | English |
| Published: |
Frontiers Media S.A.
2020-02-01
|
| Series: | Frontiers in Genetics |
| Subjects: | |
| Online Access: | https://www.frontiersin.org/article/10.3389/fgene.2020.00021/full |
| _version_ | 1828443949071597568 |
|---|---|
| author | Yang Han Yang Han Xiuli Wang Xiuli Wang Liyun Zheng Liyun Zheng Tingting Zhu Tingting Zhu Yuwei Li Yuwei Li Jiaqi Hong Congcong Xu Congcong Xu Peiguang Wang Peiguang Wang Min Gao Min Gao |
| author_facet | Yang Han Yang Han Xiuli Wang Xiuli Wang Liyun Zheng Liyun Zheng Tingting Zhu Tingting Zhu Yuwei Li Yuwei Li Jiaqi Hong Congcong Xu Congcong Xu Peiguang Wang Peiguang Wang Min Gao Min Gao |
| author_sort | Yang Han |
| collection | DOAJ |
| description | BackgroundThis study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients.MethodsWhole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. χ2- and Fisher's tests were used to analyze the genotype–phenotype correlations.Results(1) WES identified EDA missense mutations [c.1127 C > T (p.T376M; NM_001005609)] in family 1 and an EDA nonframeshift deletion mutation [c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609)] in family 2. Sanger sequencing validated the results. ANNOVAR (ANNOtate VARiation) annotation indicated that c.1127 c > T was a deleterious mutation. (2) The review of published papers revealed 68 novel mutations related to HED: 57 (83.8%) were EDA mutations, 8 (11.8%) were EDAR mutations, 2 (2.9%) were EDARADD mutations, 1 (1.5%) was a WNT10A mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype–phenotype correlation analysis revealed that patients with EDA missense mutations had a higher frequency of hypohidrosis (P = 0.021).ConclusionsThis study identified two EDA gene mutations in two Chinese Han HED families and provides a foundation for genetic diagnosis and counseling. |
| first_indexed | 2024-12-10T21:36:11Z |
| format | Article |
| id | doaj.art-9a9364235b0a44adbb8b84aad1a5656e |
| institution | Directory Open Access Journal |
| issn | 1664-8021 |
| language | English |
| last_indexed | 2024-12-10T21:36:11Z |
| publishDate | 2020-02-01 |
| publisher | Frontiers Media S.A. |
| record_format | Article |
| series | Frontiers in Genetics |
| spelling | doaj.art-9a9364235b0a44adbb8b84aad1a5656e2022-12-22T01:32:38ZengFrontiers Media S.A.Frontiers in Genetics1664-80212020-02-011110.3389/fgene.2020.00021480480Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype–Phenotype: A Correlation AnalysisYang Han0Yang Han1Xiuli Wang2Xiuli Wang3Liyun Zheng4Liyun Zheng5Tingting Zhu6Tingting Zhu7Yuwei Li8Yuwei Li9Jiaqi Hong10Congcong Xu11Congcong Xu12Peiguang Wang13Peiguang Wang14Min Gao15Min Gao16Department of Dermatology of First Affiliated Hospital, First Affiliated Hospital of Anhui Medical University, Hefei, ChinaInstitute of Dermatology, Anhui Medical University, Hefei, ChinaDepartment of Dermatology of First Affiliated Hospital, First Affiliated Hospital of Anhui Medical University, Hefei, ChinaInstitute of Dermatology, Anhui Medical University, Hefei, ChinaDepartment of Dermatology of First Affiliated Hospital, First Affiliated Hospital of Anhui Medical University, Hefei, ChinaInstitute of Dermatology, Anhui Medical University, Hefei, ChinaDepartment of Dermatology of First Affiliated Hospital, First Affiliated Hospital of Anhui Medical University, Hefei, ChinaInstitute of Dermatology, Anhui Medical University, Hefei, ChinaDepartment of Dermatology of First Affiliated Hospital, First Affiliated Hospital of Anhui Medical University, Hefei, ChinaInstitute of Dermatology, Anhui Medical University, Hefei, ChinaDepartment of Dermatology of First Affiliated Hospital, First Affiliated Hospital of Anhui Medical University, Hefei, ChinaDepartment of Dermatology of First Affiliated Hospital, First Affiliated Hospital of Anhui Medical University, Hefei, ChinaInstitute of Dermatology, Anhui Medical University, Hefei, ChinaDepartment of Dermatology of First Affiliated Hospital, First Affiliated Hospital of Anhui Medical University, Hefei, ChinaInstitute of Dermatology, Anhui Medical University, Hefei, ChinaDepartment of Dermatology of First Affiliated Hospital, First Affiliated Hospital of Anhui Medical University, Hefei, ChinaInstitute of Dermatology, Anhui Medical University, Hefei, ChinaBackgroundThis study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients.MethodsWhole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. χ2- and Fisher's tests were used to analyze the genotype–phenotype correlations.Results(1) WES identified EDA missense mutations [c.1127 C > T (p.T376M; NM_001005609)] in family 1 and an EDA nonframeshift deletion mutation [c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609)] in family 2. Sanger sequencing validated the results. ANNOVAR (ANNOtate VARiation) annotation indicated that c.1127 c > T was a deleterious mutation. (2) The review of published papers revealed 68 novel mutations related to HED: 57 (83.8%) were EDA mutations, 8 (11.8%) were EDAR mutations, 2 (2.9%) were EDARADD mutations, 1 (1.5%) was a WNT10A mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype–phenotype correlation analysis revealed that patients with EDA missense mutations had a higher frequency of hypohidrosis (P = 0.021).ConclusionsThis study identified two EDA gene mutations in two Chinese Han HED families and provides a foundation for genetic diagnosis and counseling.https://www.frontiersin.org/article/10.3389/fgene.2020.00021/fullhypohidrotic ectodermal dysplasiawhole-exome sequencingSanger sequencingectodysplasin A genegene mutation |
| spellingShingle | Yang Han Yang Han Xiuli Wang Xiuli Wang Liyun Zheng Liyun Zheng Tingting Zhu Tingting Zhu Yuwei Li Yuwei Li Jiaqi Hong Congcong Xu Congcong Xu Peiguang Wang Peiguang Wang Min Gao Min Gao Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype–Phenotype: A Correlation Analysis Frontiers in Genetics hypohidrotic ectodermal dysplasia whole-exome sequencing Sanger sequencing ectodysplasin A gene gene mutation |
| title | Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype–Phenotype: A Correlation Analysis |
| title_full | Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype–Phenotype: A Correlation Analysis |
| title_fullStr | Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype–Phenotype: A Correlation Analysis |
| title_full_unstemmed | Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype–Phenotype: A Correlation Analysis |
| title_short | Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype–Phenotype: A Correlation Analysis |
| title_sort | pathogenic eda mutations in chinese han families with hypohidrotic ectodermal dysplasia and genotype phenotype a correlation analysis |
| topic | hypohidrotic ectodermal dysplasia whole-exome sequencing Sanger sequencing ectodysplasin A gene gene mutation |
| url | https://www.frontiersin.org/article/10.3389/fgene.2020.00021/full |
| work_keys_str_mv | AT yanghan pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT yanghan pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT xiuliwang pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT xiuliwang pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT liyunzheng pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT liyunzheng pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT tingtingzhu pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT tingtingzhu pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT yuweili pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT yuweili pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT jiaqihong pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT congcongxu pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT congcongxu pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT peiguangwang pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT peiguangwang pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT mingao pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT mingao pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis |