Detection of P30 Gene to Diagnosis of Toxoplasmosis by Using Polymerase Chain Reaction
Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. In healthy persons (immunocompetent) the infection is usually asymptomatic; however in immunocompromised patients, especially AIDS patients, the infection can be fatal. Primary infection in pregnant women can be transmitted...
| Main Authors: | , , |
|---|---|
| Format: | Article |
| Language: | English |
| Published: |
Universitas Indonesia
2016-03-01
|
| Series: | Makara Journal of Health Research |
| Subjects: | |
| Online Access: | http://journal.ui.ac.id/index.php/health/article/view/5585 |
| _version_ | 1827853731655319552 |
|---|---|
| author | Lisawati Susanto Taniawati Supali Srisasi Gandahusada |
| author_facet | Lisawati Susanto Taniawati Supali Srisasi Gandahusada |
| author_sort | Lisawati Susanto |
| collection | DOAJ |
| description | Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. In healthy persons (immunocompetent) the infection is usually asymptomatic; however in immunocompromised patients, especially AIDS patients, the infection can be fatal. Primary infection in pregnant women can be transmitted to the fetus via the placenta. Therefore laboratory examination is absolutely neccesary to assess the presence of T.gondii infection hence prompt treatment can be given to prevent further damage. The aim of this study is to know whether by using P30 gene as target the Polymerase chain reaction (PCR) can detect T.gondii DNA in Indonesia. The PCR was performed on the DNA which had been isolated against P30 gene as target by using the method described by Weiss et al and Chang & Ho. The P30 gene primers consisted of oligo 1: 5'CACACGGTTGTATGTCGGTTTCGCT3 and oligo 2: 5'TCAAGGAGCTCAATGTTAC GCT3. The DNA samples used in the PCR with P30 gene as target were derived from the following materials: (a) pure T.gondii DNA of various concentrations, (b) a mixture of pure T.gondii DNA and normal human blood DNA, (c) tachyzoite DNA derived from the mixture of 99 ml normal human blood and 1 ml tachyzoite suspension with the following amount of tachyzoites :1000,100, 50, 40, 30, 20 and 10 tachyzoites. It was shown that no specific bands were observed in the PCR with P30 gene as target (performed according to the method described by Weiss et al). The PCR according to the method described by Chang & Ho did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. The results obtained showed that the minimal DNA concentrations which still could be detected using P30 gene as target were as follows : 0.001 ng DNA in 50 ml PCR solution from samples of pure DNA, 0.025 ng DNA in 50 ml PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 20 tachyzoites. It was concluded that the assay using P30 gene as target could be used for detecting T.gondii DNA in Indonesia. |
| first_indexed | 2024-03-12T11:09:58Z |
| format | Article |
| id | doaj.art-e051b0f811a54e25bf8a5cea5e4d2c23 |
| institution | Directory Open Access Journal |
| issn | 2356-3664 2356-3656 |
| language | English |
| last_indexed | 2024-03-12T11:09:58Z |
| publishDate | 2016-03-01 |
| publisher | Universitas Indonesia |
| record_format | Article |
| series | Makara Journal of Health Research |
| spelling | doaj.art-e051b0f811a54e25bf8a5cea5e4d2c232023-09-02T03:09:20ZengUniversitas IndonesiaMakara Journal of Health Research2356-36642356-36562016-03-01513810.7454/msk.v5i1.55853222Detection of P30 Gene to Diagnosis of Toxoplasmosis by Using Polymerase Chain ReactionLisawati Susanto0Taniawati Supali1Srisasi Gandahusada2Bagian Parasitologi, Fakultas Kedokteran, Universitas Indonesia, Jakarta 10430Bagian Parasitologi, Fakultas Kedokteran, Universitas Indonesia, Jakarta 10430Bagian Parasitologi, Fakultas Kedokteran, Universitas Indonesia, Jakarta 10430Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. In healthy persons (immunocompetent) the infection is usually asymptomatic; however in immunocompromised patients, especially AIDS patients, the infection can be fatal. Primary infection in pregnant women can be transmitted to the fetus via the placenta. Therefore laboratory examination is absolutely neccesary to assess the presence of T.gondii infection hence prompt treatment can be given to prevent further damage. The aim of this study is to know whether by using P30 gene as target the Polymerase chain reaction (PCR) can detect T.gondii DNA in Indonesia. The PCR was performed on the DNA which had been isolated against P30 gene as target by using the method described by Weiss et al and Chang & Ho. The P30 gene primers consisted of oligo 1: 5'CACACGGTTGTATGTCGGTTTCGCT3 and oligo 2: 5'TCAAGGAGCTCAATGTTAC GCT3. The DNA samples used in the PCR with P30 gene as target were derived from the following materials: (a) pure T.gondii DNA of various concentrations, (b) a mixture of pure T.gondii DNA and normal human blood DNA, (c) tachyzoite DNA derived from the mixture of 99 ml normal human blood and 1 ml tachyzoite suspension with the following amount of tachyzoites :1000,100, 50, 40, 30, 20 and 10 tachyzoites. It was shown that no specific bands were observed in the PCR with P30 gene as target (performed according to the method described by Weiss et al). The PCR according to the method described by Chang & Ho did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. The results obtained showed that the minimal DNA concentrations which still could be detected using P30 gene as target were as follows : 0.001 ng DNA in 50 ml PCR solution from samples of pure DNA, 0.025 ng DNA in 50 ml PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 20 tachyzoites. It was concluded that the assay using P30 gene as target could be used for detecting T.gondii DNA in Indonesia.http://journal.ui.ac.id/index.php/health/article/view/5585Toxoplasma gondiiDNAP30 gene |
| spellingShingle | Lisawati Susanto Taniawati Supali Srisasi Gandahusada Detection of P30 Gene to Diagnosis of Toxoplasmosis by Using Polymerase Chain Reaction Makara Journal of Health Research Toxoplasma gondii DNA P30 gene |
| title | Detection of P30 Gene to Diagnosis of Toxoplasmosis by Using Polymerase Chain Reaction |
| title_full | Detection of P30 Gene to Diagnosis of Toxoplasmosis by Using Polymerase Chain Reaction |
| title_fullStr | Detection of P30 Gene to Diagnosis of Toxoplasmosis by Using Polymerase Chain Reaction |
| title_full_unstemmed | Detection of P30 Gene to Diagnosis of Toxoplasmosis by Using Polymerase Chain Reaction |
| title_short | Detection of P30 Gene to Diagnosis of Toxoplasmosis by Using Polymerase Chain Reaction |
| title_sort | detection of p30 gene to diagnosis of toxoplasmosis by using polymerase chain reaction |
| topic | Toxoplasma gondii DNA P30 gene |
| url | http://journal.ui.ac.id/index.php/health/article/view/5585 |
| work_keys_str_mv | AT lisawatisusanto detectionofp30genetodiagnosisoftoxoplasmosisbyusingpolymerasechainreaction AT taniawatisupali detectionofp30genetodiagnosisoftoxoplasmosisbyusingpolymerasechainreaction AT srisasigandahusada detectionofp30genetodiagnosisoftoxoplasmosisbyusingpolymerasechainreaction |