Summary: | The research was conduct to know polymorphism GH gene and allele
frequency of FH, and associated of effect of genotype and breed with milk yield,
fat and protein content. The research was conduct at BPTU-HPT Baturraden,
and Animal Breeding Laboratory UGM. The research was use 62 FH at BPTUHPT
Baturraden, consist of 19 FH imported from New Zealand and 43 FH
imported from Australia. Blood sampel for DNA molecular analysis was
conducted by DNA isolation with SDS-PK modification method, DNA
amplification with Polymerase Chain Reaction (PCR) method use the primer pair,
GH-Forward: 5�-GCTGCTCC TGAGGGCCCTTC-3� and GH-reverse: 5�-
CATGACCCTCAGGTACGTCTC CG-3�, and digesti with Restriction Fragment
Length Polymorphism (RLFP) method. Association between effect of genotype
and breed with milk production can know by Randomized Complete Block
Design (RCBD) analysis. Identification of GH gene polymorphism was conducted
by digested the DNA fragment of 211 bp by Alu I enzyme. The result indicated
that Sequencing alignment prove that the sequence of FH was found Single
Nucleotide Polymorphism (SNP), where there is substitution cytocin (C) to
guanine (G) at position 2141 (GenBank No.M57764) which resulted in changes
in the amino acid sequence leucine to valine. Frequencies of L and V allele in FH
imported from New Zealand 0.92 and 0.08 respectively with genotype LL 0.84
and LV 0.16. Frequencies of L and V allele in FH imported from Australia 0.90
and 0.10 respectively with genotype LL 0.79 and LV 0.21. In this study indicated
that effect of genotype with milk yield, fat and protein content have not
significant, but effect of breed with fat and protein milk content have significant.
The conclusion this research showed that was found polymorphism in FH cows
at BBPTU-HPT Baturraden. Associated between genotype with milk yield, fat
and protein content was not found, but FH with LV genotype have positive effect
for milk yield. Associated between breed with fat and protein content was found
in FH cows at BPTU-HPT Baturraden. FH imported from Australia have higher
than FH imported from New Zealand on fat and protein content
Keywords: Polymorphism, Growth hormone gene, Milk production, Friesian
Holstein
|