Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome by De Nicola, Beatrice, Lech, Christopher J., Heddi, Brahim, Regmi, Sagar, Frasson, Ilaria, Perrone, Rosalba, Richter, Sara N., Phan, Anh Tuân

Subjects: “…Nuclear Magnetic Resonance (NMR)…”
Get full text
Get full text

Folding simulation of amyloid β-peptide in alzheimer's disease. by Koh, Jessica Li Jian.

“…The structure obtained at dielectric constant of 80 was closer to the nuclear magnetic resonance (NMR) structure, forming a helix with a kink centered near V12. …”
Get full text

Engineering of interlocked DNA G-quadruplexes as a robust scaffold by Phan, Anh Tuân, Do, Ngoc Quang

“…In this study, we formulated a rule to engineer (3+1) interlocked dimeric G-quadruplexes and established the folding topology of the designed DNA sequences by nuclear magnetic resonance spectroscopy. These interlocked G-quadruplexes are very stable and can serve as compact robust scaffolds for various applications. …”
Get full text
Get full text

Structural characterization and fire performance of geopolymer-glass fiber composite panels by Ye, Kai, Dasari, Aravind, Hooper, Thomas J. N.

“…X-ray diffraction and solid-state nuclear magnetic resonance spectroscopy were used to understand the changes in structure and evolution of phases with temperature. …”
Get full text

Docking in metal-organic frameworks by Miljanić, Ognjen Š., Knobler, Carolyn B., Yaghi, Omar M., Li, Qiaowei, Zhang, Wenyu, Sue, Chi Hau, Zhao, Yanli, Liu, Lihua, Stoddart, J. Fraser

“…This act of specific complexation yields quantitatively the corresponding MOF-1001 pseudorotaxanes, as confirmed by x-ray diffraction and by solid- and solution-state nuclear magnetic resonance spectroscopic studies performed on MOF-1001, its pseudorotaxanes, and their molecular strut precursors. …”
Get full text
Get full text

Evidence for filamentary superconductivity nucleated at antiphase domain walls in antiferromagnetic CaFe2As2 by Hu, Tao, Tee, Xianyang, Panagopoulos, Christos, Xiao, H., Dioguardi, A. P., apRoberts-Warren, N., Shockley, A. C., Crocker, J., Nisson, D. M., Viskadourakis, Z., Radulov, I., Almasan, C. C., Curro, N. J.

“…Resistivity, magnetization, and microscopic 75As nuclear magnetic resonance (NMR) measurements in the antiferromagnetically ordered state of the iron-based superconductor parent material CaFe2As2 exhibit anomalous features that are consistent with the collective freezing of domain walls. …”
Get full text
Get full text

Graphite oxides : effects of permanganate and chlorate oxidants on the oxygen composition by Chua, Chun Kiang, Sofer, Zdeněk, Pumera, Martin

“…The structural characterizations of the GOs would be probed by using high resolution X-ray photoelectron spectroscopy, nuclear magnetic resonance, Fourier transform infrared spectroscopy, and Raman spectroscopy. …”
Get full text
Get full text

First principles molecular dynamics study of filled ice hydrogen hydrate by Zhang, Jingyun, Kuo, Jer-Lai, Iitaka, Toshiaki

“…These results would encourage further experimental studies, especially nuclear magnetic resonance spectroscopy and neutron scattering, on the phases of filled-ice hydrates at high pressures and/or low temperatures.…”
Get full text
Get full text

Si(II) cation-promoted formation of an abnormal NHC-bound silylene and a cAAC-silanyl radical ion by Zhu, Keke, Dutta, Sayan, Han, Weichun, Wang, Chenfeng, Lee, Jiawen, Tan, Gengwen, Koley, Debasis, So, Cheuk-Wai, Li, Yan

“…All of the products were characterized by nuclear magnetic resonance spectroscopy, electron paramagnetic resonance, and X-ray crystallography, and their bonding scenarios were investigated by density functional theory calculations. …”
Get full text

Single-molecule force spectroscopy reveals cation-π interactions in aqueous media are highly affected by cation dehydration by Di, Weishuai, Xue, Kai, Cai, Jun, Zhu, Zhenshu, Li, Zihan, Fu, Hui, Lei, Hai, Hu, Wenbing, Tang, Chun, Wang, Wei, Cao, Yi

“…Here, we studied the cation-π binding strength and mechanism by pulling two hydrophobic polymers with distinct cation binding properties, i.e., poly-pentafluorostyrene and polystyrene, in aqueous media using single-molecule force spectroscopy and nuclear magnetic resonance measurement. We found that the interaction strengths linearly depend on the cation concentrations, following the order of Li^{+}<NH_{4}^{+}<Na^{+}<K^{+}. …”
Get full text

Turning on the biradical state of tetracyano-perylene and quaterrylenequinodimethanes by incorporation of additional thiophene rings by Zeng, Zebing, Lee, Sangsu, Zafra, José L., Ishida, Masatoshi, Bao, Nina, Webster, Richard David, López Navarrete, Juan T., Ding, Jun, Casado, Juan, Kim, Dongho, Wu, Jishan

“…The ground state geometries and electronic structures of QDTP and QDTQ were systematically studied by variable-temperature nuclear magnetic resonance, electron spin resonance, superconducting quantum interference device measurements and FT Raman spectroscopy, assisted by density functional theory calculations. …”
Get full text
Get full text

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter by Wang, Zi-Fu, Li, Ming-Hao, Chu, I-Te, Winnerdy, Fernaldo Richtia, Phan, Anh Tuân, Chang, Ta-Chau

“…Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. …”
Get full text

B-H bond activation by an amidinate-stabilized amidosilylene : non-innocent amidinate ligand by Khoo, Sabrina, Shan, Yu-Liang, Yang, Ming-Chung, Li, Yongxin, Su, Ming-Der, So, Cheuk-Wai

“…Compounds 2-4 and 6 were characterized by nuclear magnetic resonance spectroscopy and X-ray crystallography.…”
Get full text

Probe optimization for quantum metrology via closed-loop learning control by Yang, Xiaodong, Thompson, Jayne, Wu, Ze, Gu, Mile, Peng, Xinhua, Du, Jiangfeng

“…We confirm its feasibility and certain superiorities over standard quantum metrology schemes by numerical analysis and proof-of-principle experiments in a nuclear magnetic resonance system.…”
Get full text

Formation of corrugated n = 1 2D tin iodide perovskites and their use as lead-free solar absorbers by Febriansyah, Benny, Lekina, Yulia, Kaur, Jagjit, Hooper, Thomas J. N., Harikesh, Padinhare Cholakkal, Salim, Teddy, Lim, Ming Hui, Koh, Teck Ming, Chakraborty, Sudip, Shen, Zexiang, Mathews, Nripan, England, Jason

Get full text