Identification of Fungi in Flaxseed (<i>L. usitatissimum</i> L.) Using the ITS1 and ITS2 Intergenic Regions
Flaxseed (<i>Linum usitatissimum</i> L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations...
| Main Authors: | , , , , , |
|---|---|
| Format: | Article |
| Language: | English |
| Published: |
MDPI AG
2022-06-01
|
| Series: | Microbiology Research |
| Subjects: | |
| Online Access: | https://www.mdpi.com/2036-7481/13/2/24 |
| _version_ | 1797484342882074624 |
|---|---|
| author | Nathalia de Castro Rollemberg Guilherme de Souza Hassemer Milena Dutra Pierezan Bruna Marchesan Maran Flávia Michelon Dalla Nora Silvani Verruck |
| author_facet | Nathalia de Castro Rollemberg Guilherme de Souza Hassemer Milena Dutra Pierezan Bruna Marchesan Maran Flávia Michelon Dalla Nora Silvani Verruck |
| author_sort | Nathalia de Castro Rollemberg |
| collection | DOAJ |
| description | Flaxseed (<i>Linum usitatissimum</i> L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of this work was to identify the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach. Fungal identification was performed via high-performance sequencing of the ITS1 region using ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) as primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., San Diego, CA, USA). Six genera and eight species of fungi were found in the sample. The genus <i>Aspergillus</i> stood out with three xerophilic species found, <i>A. cibarius</i>, <i>A. Appendiculatus,</i> and <i>A. amstelodami</i>, the first being the most abundant. The second most abundant genus was <i>Wallemia</i>, with the species <i>W. muriae</i>. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins. Metataxonomics has proved to be a complete, fast, and efficient method to identify different fungi. Furthermore, high-performance genetic sequencing is an important ally in research, helping to develop novel technological advances related to food safety. |
| first_indexed | 2024-03-09T23:02:08Z |
| format | Article |
| id | doaj.art-93b5a70abc7f45abb8b3d517cc6f6e42 |
| institution | Directory Open Access Journal |
| issn | 2036-7481 |
| language | English |
| last_indexed | 2024-03-09T23:02:08Z |
| publishDate | 2022-06-01 |
| publisher | MDPI AG |
| record_format | Article |
| series | Microbiology Research |
| spelling | doaj.art-93b5a70abc7f45abb8b3d517cc6f6e422023-11-23T17:59:46ZengMDPI AGMicrobiology Research2036-74812022-06-0113231532210.3390/microbiolres13020024Identification of Fungi in Flaxseed (<i>L. usitatissimum</i> L.) Using the ITS1 and ITS2 Intergenic RegionsNathalia de Castro Rollemberg0Guilherme de Souza Hassemer1Milena Dutra Pierezan2Bruna Marchesan Maran3Flávia Michelon Dalla Nora4Silvani Verruck5Department of Food Science and Technology, Federal University of Santa Catarina, Rodovia Admar Gonzaga, 1346, Itacorubi, Florianópolis 88034-000, SC, BrazilDepartment of Food Engineering, Regional Integrated University of Alto Uruguai e das Missões, Avenida Sete de Setembro, 1621, Fátima, Erechim 99709-910, RS, BrazilDepartment of Food Science and Technology, Federal University of Santa Catarina, Rodovia Admar Gonzaga, 1346, Itacorubi, Florianópolis 88034-000, SC, BrazilDepartment of Food Science and Technology, Federal University of Santa Catarina, Rodovia Admar Gonzaga, 1346, Itacorubi, Florianópolis 88034-000, SC, BrazilDepartment of Food Science and Technology, Federal University of Santa Maria, Avenida Roraima, 1000, Camobi, Santa Maria 97105-900, RS, BrazilDepartment of Food Science and Technology, Federal University of Santa Catarina, Rodovia Admar Gonzaga, 1346, Itacorubi, Florianópolis 88034-000, SC, BrazilFlaxseed (<i>Linum usitatissimum</i> L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of this work was to identify the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach. Fungal identification was performed via high-performance sequencing of the ITS1 region using ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) as primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., San Diego, CA, USA). Six genera and eight species of fungi were found in the sample. The genus <i>Aspergillus</i> stood out with three xerophilic species found, <i>A. cibarius</i>, <i>A. Appendiculatus,</i> and <i>A. amstelodami</i>, the first being the most abundant. The second most abundant genus was <i>Wallemia</i>, with the species <i>W. muriae</i>. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins. Metataxonomics has proved to be a complete, fast, and efficient method to identify different fungi. Furthermore, high-performance genetic sequencing is an important ally in research, helping to develop novel technological advances related to food safety.https://www.mdpi.com/2036-7481/13/2/24metataxonomicsgenomicsflaxseedfungigenetic sequencing |
| spellingShingle | Nathalia de Castro Rollemberg Guilherme de Souza Hassemer Milena Dutra Pierezan Bruna Marchesan Maran Flávia Michelon Dalla Nora Silvani Verruck Identification of Fungi in Flaxseed (<i>L. usitatissimum</i> L.) Using the ITS1 and ITS2 Intergenic Regions Microbiology Research metataxonomics genomics flaxseed fungi genetic sequencing |
| title | Identification of Fungi in Flaxseed (<i>L. usitatissimum</i> L.) Using the ITS1 and ITS2 Intergenic Regions |
| title_full | Identification of Fungi in Flaxseed (<i>L. usitatissimum</i> L.) Using the ITS1 and ITS2 Intergenic Regions |
| title_fullStr | Identification of Fungi in Flaxseed (<i>L. usitatissimum</i> L.) Using the ITS1 and ITS2 Intergenic Regions |
| title_full_unstemmed | Identification of Fungi in Flaxseed (<i>L. usitatissimum</i> L.) Using the ITS1 and ITS2 Intergenic Regions |
| title_short | Identification of Fungi in Flaxseed (<i>L. usitatissimum</i> L.) Using the ITS1 and ITS2 Intergenic Regions |
| title_sort | identification of fungi in flaxseed i l usitatissimum i l using the its1 and its2 intergenic regions |
| topic | metataxonomics genomics flaxseed fungi genetic sequencing |
| url | https://www.mdpi.com/2036-7481/13/2/24 |
| work_keys_str_mv | AT nathaliadecastrorollemberg identificationoffungiinflaxseedilusitatissimumilusingtheits1andits2intergenicregions AT guilhermedesouzahassemer identificationoffungiinflaxseedilusitatissimumilusingtheits1andits2intergenicregions AT milenadutrapierezan identificationoffungiinflaxseedilusitatissimumilusingtheits1andits2intergenicregions AT brunamarchesanmaran identificationoffungiinflaxseedilusitatissimumilusingtheits1andits2intergenicregions AT flaviamichelondallanora identificationoffungiinflaxseedilusitatissimumilusingtheits1andits2intergenicregions AT silvaniverruck identificationoffungiinflaxseedilusitatissimumilusingtheits1andits2intergenicregions |