Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology
<p>Abstract</p> <p>Background</p> <p>Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be toler...
| Main Authors: | , , , , , |
|---|---|
| Format: | Article |
| Language: | English |
| Published: |
BMC
2007-07-01
|
| Series: | BMC Biotechnology |
| Online Access: | http://www.biomedcentral.com/1472-6750/7/44 |
| _version_ | 1818229538200485888 |
|---|---|
| author | Wongsrikeao Pimprapar Kudo Toshiyuki Kunishi Miho Sutou Shizuyo Miyagishi Makoto Otoi Takeshige |
| author_facet | Wongsrikeao Pimprapar Kudo Toshiyuki Kunishi Miho Sutou Shizuyo Miyagishi Makoto Otoi Takeshige |
| author_sort | Wongsrikeao Pimprapar |
| collection | DOAJ |
| description | <p>Abstract</p> <p>Background</p> <p>Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine <it>PRNP</it> (b<it>PRNP</it>) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down b<it>PRNP</it> were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of <it>PRNP</it>, and lengths of siRNAs.</p> <p>Results</p> <p>Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNA<sup>Val </sup>promoter. Six target sites of bovine <it>PRNP </it>were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire b<it>PRNP </it>coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or <it>Renilla </it>luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a <it>Bsp </it>MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting.</p> <p>Conclusion</p> <p>Four siRNA expression plasmid vectors, six target sites of b<it>PRNP</it>, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of b<it>PRNP </it>in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.</p> |
| first_indexed | 2024-12-12T10:20:11Z |
| format | Article |
| id | doaj.art-9f7d92c2f527468a8d12f0a9deda66dd |
| institution | Directory Open Access Journal |
| issn | 1472-6750 |
| language | English |
| last_indexed | 2024-12-12T10:20:11Z |
| publishDate | 2007-07-01 |
| publisher | BMC |
| record_format | Article |
| series | BMC Biotechnology |
| spelling | doaj.art-9f7d92c2f527468a8d12f0a9deda66dd2022-12-22T00:27:34ZengBMCBMC Biotechnology1472-67502007-07-01714410.1186/1472-6750-7-44Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technologyWongsrikeao PimpraparKudo ToshiyukiKunishi MihoSutou ShizuyoMiyagishi MakotoOtoi Takeshige<p>Abstract</p> <p>Background</p> <p>Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine <it>PRNP</it> (b<it>PRNP</it>) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down b<it>PRNP</it> were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of <it>PRNP</it>, and lengths of siRNAs.</p> <p>Results</p> <p>Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNA<sup>Val </sup>promoter. Six target sites of bovine <it>PRNP </it>were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire b<it>PRNP </it>coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or <it>Renilla </it>luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a <it>Bsp </it>MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting.</p> <p>Conclusion</p> <p>Four siRNA expression plasmid vectors, six target sites of b<it>PRNP</it>, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of b<it>PRNP </it>in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.</p>http://www.biomedcentral.com/1472-6750/7/44 |
| spellingShingle | Wongsrikeao Pimprapar Kudo Toshiyuki Kunishi Miho Sutou Shizuyo Miyagishi Makoto Otoi Takeshige Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology BMC Biotechnology |
| title | Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology |
| title_full | Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology |
| title_fullStr | Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology |
| title_full_unstemmed | Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology |
| title_short | Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology |
| title_sort | knockdown of the bovine prion gene prnp by rna interference rnai technology |
| url | http://www.biomedcentral.com/1472-6750/7/44 |
| work_keys_str_mv | AT wongsrikeaopimprapar knockdownofthebovinepriongeneprnpbyrnainterferencernaitechnology AT kudotoshiyuki knockdownofthebovinepriongeneprnpbyrnainterferencernaitechnology AT kunishimiho knockdownofthebovinepriongeneprnpbyrnainterferencernaitechnology AT sutoushizuyo knockdownofthebovinepriongeneprnpbyrnainterferencernaitechnology AT miyagishimakoto knockdownofthebovinepriongeneprnpbyrnainterferencernaitechnology AT otoitakeshige knockdownofthebovinepriongeneprnpbyrnainterferencernaitechnology |