Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter
Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II...
| Main Authors: | , , , , , |
|---|---|
| Other Authors: | |
| Format: | Journal Article |
| Language: | English |
| Published: |
2020
|
| Subjects: | |
| Online Access: | https://hdl.handle.net/10356/145155 |