Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II...

Full description

Bibliographic Details
Main Authors: Wang, Zi-Fu, Li, Ming-Hao, Chu, I-Te, Winnerdy, Fernaldo Richtia, Phan, Anh Tuân, Chang, Ta-Chau
Other Authors: School of Physical and Mathematical Sciences
Format: Journal Article
Language:English
Published: 2020
Subjects:
Science
Cytosine
WNT1
Online Access:https://hdl.handle.net/10356/145155

Similar Items

Similar Items